Skip to main navigation Skip to search Skip to main content

Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases

  • Fengli Du
  • , Guangxin Wang
  • , Dawei Wang
  • , Guoying Su
  • , Guixiang Yao
  • , Wei Zhang*
  • , Guohai Su*
  • *Corresponding author for this work

Research output: Journal Publications and ReviewsRGC 21 - Publication in refereed journalpeer-review

74 Downloads (CityUHK Scholars)

Abstract

Introduction: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2. Patient concerns: A Chinese Han family with LQTS phenotypes was examined. Diagnosis: A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made. Interventions: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day. Outcomes: This novel heterozygous mutation results in a frameshift mutation after the 128th residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156). Conclusion: This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.
Original languageEnglish
Article numbere19749
Number of pages5
JournalMedicine (United States)
Volume99
Issue number16
DOIs
Publication statusPublished - Apr 2020

Research Keywords

  • KCNH2 gene
  • long QT syndrome
  • LQT2
  • mutation
  • next-generation sequencing

Publisher's Copyright Statement

  • This full text is made available under CC-BY 4.0. https://creativecommons.org/licenses/by/4.0/

Fingerprint

Dive into the research topics of 'Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases'. Together they form a unique fingerprint.

Cite this